Aditum Journal of Clinical and Biomedical Research
OPEN ACCESS | Volume 7 - Issue 1 - 2025
ISSN No: 2993-9968 | Journal DOI: 10.61148/2993-9968/AJCBR
Michel Leclerc
Immunology of Invertebrates, Div: Biochem/Biology, Orléans University (France) 556 rue Isabelle Romée, 45640 Sandillon (France).
*Corresponding Author: Michel Leclerc, Immunology of Invertebrates, Div: Biochem/Biology, Orléans University (France) 556 rue Isabelle Romée, 45640 Sandillon (France).
Received: October 11, 2021
Accepted: October 20, 2021
Published: October 29, 2021
Citation: Michel Leclerc. (2021) “IG V-L K appa Expression from Sea Star Igkappa Gene.”, Aditum Journal of Clinical and Biomedical Research, 3(1); DOI: http;//doi.org/010.2021/1.1057.
Copyright: © 2021 Michel Leclerc. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly Cited.
The sea star IGKappa gene was cloned in 2014 by the use of primers. It was compared in the present work to Vertebrate Immunoglobulin genes. A high identity was found with these last ones. A length of 105 amino acids fit with Immunoglobulin domain
Introduction:
The sequence of the sea star Asterias rubens IGKappa gene was described by our team, in 2014(Ref 1). Since we have tried to find homologies between this gene and upper genes from lower Vertebrates to human genes.
We report, in the precedent paper, results obtained with upper Vertebrate genes by the use of blasts directed against these last ones (Ref 2, 3)
Results:
The sequence of the sea star IGKappa gene is the following (Ref 1):
5’GGA TCC GGA GGA ATG CGTGGCAACATGGCGTCTCTATGGATGTTCTTCTT
TGTCGTGGGGATAACTTTACAACGGAGTTTGGCGATTTACACGTTTCGCG
AGCAACCGTCGGACACTAGCGCGTTGCAGGGGAGCACAGTGGTGCTTCAC
TGCTCCGTTGAGCAGTACATAAACACCACGGCCATCGTTTGGTGGAGCCG
TGACTCGGTCATCAGCCACAACAAAGACCTGAAACTGTCCAGTCTAAACA
CCGACCAGCTCCAAAGGTACTCGATTTCAGGCGACGCATCTCGGGGGGAA
TTCAACCTTAAAATAGTGAACTTTACCGCCACAGACGCCGCCAGTTACCG
CTGTCAGATG TAA GAA TTC3’
The bioinformatic work leads us to show similarities between sea star IGKappa gene and Immunoglobulin domain from Vertebrates

Non-specific hits: IgV_L_Kappa
[Non-specific hit, evalue = 6.79e-03] cd04980, Immunoglobulin (Ig) light chain, kappa type, variable (V) domain; The members here are composed of the immunoglobulin (Ig) light chain, kappa type, variable (V) domain. This group contains the standard Ig superfamily V-set AGFCC'C"/DEB domain topology.
Super-families: Ig superfamily
[Superfamily, evalue = 6.79e-03] cl11960, Immunoglobulin domain; The members here are composed of the immunoglobulin (Ig) domain found in the Ig superfamily.
The Table 1, as shown below, resumes our results:We observe again the Immunoglobulin domain and a particular one without immune function.

Two region features:
Comment: Immunoglobulin
Location: 47…151
Length: 105 aa
CDD: 214652
Comment: U3 small nucleolar RNA-associated protein 14 (function unknown)
Location: 731…866
Length: 136 aa
CDD: 227931
Table 1: PREDICTED: Asterias rubens uncharacterized LOC117296905 (LOC117296905
Conclusion: We retain from this bioinformatic analysis, the presence of Immunoglobulin domain in the sea star IGKappa gene with the CDD:214652. This gene, nevertheless, seems less evolved that the Ophuirid IGKappa gene we discovered 1 month ago (Ref4) in terms of Immune functions.
These 2 genes from Echinodermata (Invertebrates) bring us a new light in Immunogenetic World and mainly in Comparative Immunology between Invertebrates and Vertebrates animals.